Home ==> PCR of Target Gene Page

Welcome to the PCR (Polymerase Chain Reaction) of Target Gene Page!

BACKGROUND INFORMATION ON PCR:

PCR is useful not only in selecting a specific piece of a gene, but amplifying the piece to a very high concentration, which means a lot of a specific piece of DNA can be made from a relatively small initial amount. The ability of PCR to make very high concentrations of a specific gene sequence greatly reduces the amount of original DNA needed and can cut a large gene sequence down to a manageable size.

How PCR Works:
The sample DNA is initially heated to 94-96 degrees Celsius for several minutes to break apart the hydrogen bonds between the nucleotide bases, separating the double stranded DNA into two single strands. Next, the temperature is lowered to 50-65 degrees Celsius to allow the forward and reverse primers to anneal to the DNA. The primers are coded to only anneal to a complementary DNA sequence, and the forward and reverse primers run towards each other on complimentary strands, allowing a certain sequence to be amplified. The temperature is then raised to around 72 degrees Celsius to boost DNA synthesis (the making of a new strand of DNA). This cycle of 95 degrees, 50-65 degrees, then 72 degrees is repeated around thirty times to allow for many amplifications of only the target sequence (the animation below does a very good job of illustrating this point).


Above is a step by step animation of how PCR works
Click the link, then click run
Once the file is open click Amplification to get the animation
Only works on PC's


PCR in the Lab:
PCR was used in the lab to amplify the DPY-10 gene. The amplified section of the gene could then be ligated into the L4440 vector after being digested with restriction enzymes. The PCR allowed us to make a very high concentration of the amplified section of DPY-10 from a small initial amount, which made the ligation have a much greater chance of success since there was a greater chance the L4440 would ligate with the inserted DPY-10 piece than back to itself since there was so much more of the insert.

We also used PCR to confirm that the transformed cells contained the L4440 with a DPY-10 segment ligated into it. The primers were designed to bind to the T7 promoters flanking the region where the DPY-10 was inserted. If the L4440 did not contain the DPY-10 insert then the PCR would amplify the ~100 bp section between the T7 promoters, but if the L4440 contained the DPY-10 insert then the PCR would amplify the ~100 bp section plus the 291 bp DPY-10 insert, making a segment ~391 bp long. When run through gel electrophoresis, the PCR product would show as a band ~100 bp long if the ligation failed, or ~391 bp long if the ligation was successful.

AMPLIFYING THE DPY-10 GENE:
GOAL:
-We must create primers that amplify a portion of the DPY-10 genomic DNA.
-When creating the primers we must add extra nucleotides to each end that code for specific restriction enzyme sites, so that the amplified product can be digested and ligated into the L4440 vector
-The 2 restriction enzymes chosen must cut within the multiple cloning site of the L4440 vector, but not within the gene of interest

CAUTIONS:
-The amplified genomic DNA must be big enough to be detected on a gel after being ligated with the L4440 vector
-You must choose 2 restriction enzymes to increase the chances of a successful ligation, so that the L4440 vector will not re-ligate back together
-The 2 chosen enzymes must be compatible in a double digest (must be compatible in the same NEB buffer, we chose buffer 2)
-The primers must have a melting temperature of within 1 degree Celsius of each other
HOW TO MAKE PRIMERS:
- We found the sequence of the DPY-10 gene at http://wormbase.org
PICTURED BELOW: The portion of the DPY-10 gene sequence that we used
agatcaaacgacgaggctgcacttgaacttcaatacggcaagatgagaatgactggaaaccgtaccgctcgtggtgccta
tggtagcggagcttcacatggcttcagaccaacagcctatggagatgaaatcactggagctccacttgaaactgaatgtc
caggatgttgcattccaggaccaccaggtccacgtggatcatctggaacaccaggaaaacctggacttccaggaaacgct
ggaaagccaggaatgccaggaactactccaaatcaaacatgcccactcaaccaagttcgtgagccaccaccgtgccgtcc
atgtccaaagggaccaccaggaatcaagggatggccaggattcccaggagatgttgggccaccaggaccaccaggactta
agggaattgatggtgaagacggagcaccaggagagactggaccaactggaccaccaggatacagaggaggaccaggagct
cctggagataagggaccaactccagaaggtgacttgaaggagggaccaccaggagacgaaggaccaccaggaccaattgg
agctccaggaatgcctggattaccaggaagaaacggattgaccggaggacaaggagaacgaggatggccgggagtttctg
gagaatctggtgagccaggatatccaggaccagaaggaccaatgggaggacaaggaccaccag
-We chose a sequence that was long enough, without be excessively long, and that was located in an exon (a region that codes for mRNA)
-We took that sequence, pasted it into NEB cutter at www.neb.com , and looked at the enzymes that cut it 0 times
PICTURED BELOW: The restriction map of the DPY-10 gene (as you can see SacII and HindIII have no restriction site, and therefore do not cut the DPY-10 gene)
Picture_3.png
-While looking at the enzymes that didn't cut the DPY-10 gene, we looked for two enzymes that cut within the multiple cloning site of the L4440 vector
-We chose the enzymes SacII and HindIII
PICTURED BELOW: The multiple cloning site of L4440 (as you can see SacII and HindIII do cut within the MCS)
pgvec1.jpg.jpeg
-We then went to the "Primer Quest" section on www.IDTDNA.com, and entered the DPY-10 gene sequence (sequence pictured/ written above)
-We clicked calculate, and chose a set of primers that would amplify a piece of DNA long enough to be noticed on a gel. Although 5 different sets of primers were available, we chose a set that amplified a piece of DNA that was roughly 290bp
PICTURED BELOW: The unmodified set of primers that we chose
Picture_2.png
-We then had to edit the primers to add the nucleotide sequences to the 5' end of the primers SacII and HindIII
-We added a few extra nucleotides to the 5' ends so that the primers had a place to clamp on to before amplifying the genomic DNA
-To make sure that the melting temperatures were within 1 degree Celsius of each other we added guanine or cytosine nucleotides to raise the melting temperature, and adenine or thymine to keep it relatively the same
-We put the final product on our baskets to order, just to find out that Dean Mac already had them
FORWARD PRIMER:
5'- GGG GAA GCT TAT GTC CAA AGG GAC CAC CAG GAA T -3'
BOLD= HindIII restriction site
REVERSE PRIMER:

5'- AAA ACC GCG GTG TCC TCC GGT CAA TCC GTT TCT T -3'

BOLD= SacII restriction site

PCR PROTOCOL:
Add to a PCR tube:
-1 ul 10 uM forward primer
-1 ul 10 uM reverse primer
-10 ul worm DNA
-25 ul Taq Polymerase
-13 ul distilled water

Thermal Cycler PCR Program:
-95 degrees Celsius for 30 seconds-- 1 cycle
-95 degress Celsius for 30 seconds then,
-66 degrees Celsius for 60 seconds then,
-68 degrees Celsius for 60 seconds-- 30 cycles
-68 degrees Celsius for 5 minutes-- 1 cycle
-Hold at 4 degrees Celsius

Insert the PCR tube into the set thermal cycler and let it run for the duration.


GEL PICTURE:
PICTURED BELOW: A gel of the PCR product and digested and undigested L4440:
PCR tube 1 and PCR tube 2 had no amplification, as evidenced by the fact that there are no bands of DNA on the gel in those lanes:
rod_and_maxine_.png
Edited by Maxine Lammers and Rod Maier